Nanostrukturierte Glas-Keramik-Beschichtungen für orthopädische Anwendungen - Teil 3


2.2 Haftfestigkeit und Mikrohärte

   Die Haftzugfestigkeit zwischen Beschichtung und   Substrat   war   gemessen   im   Übereinstimmung   mit   ASTM   C-633-79.   Das   testen   Verfahren   können   Sein   gefunden   im   unsere bisherige Arbeit [ 32 ]. Fünf Proben wurden unabhängig getestet   zum   jeder   Art   von   Beschichtungen   und   das   Ergebnisse   wurden gemeldet   wie   Mittelwert ± sd

Die Mikrohärte der Beschichtungen wurde an polierten Beschichtungsoberflächen mit einem Shimadzu-Mikrohärteprüfgerät (Shimadzu Co., Japan) mit einer Last von 300 gf und geprüft   ein   Wird geladen   Zeit   von   15 s.   Vor   testen,   Beschichtungen   wurden unterworfen   zu   Feine   Polieren.   Härte   Werte   wurden aufgezeichnet   auf   fünfzehn   anders   Positionen.  

Das   Ergebnisse   präsentiert werden   wie   bedeuten ± sd

 


Tabelle 1. Primer für RT-PCR– HOB-bezogene Marker.


Gen

Sequenz   ( 5 '   - 3 ' )

Schmelztemperatur (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


Kollagen Typ I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Ionenfreisetzung und azelluläre Mineralisierungstests

     Um das Ionenfreisetzungsverhalten von HT- und SP-Beschichtungen zu messen, wurden sie 7 Tage in 15 ml Natriumchloridlösung (pH 7,4) gepuffert, die mit Tris (hydroxymethyl) aminomethan und Salzsäure (HCl-Tris-gepufferte Lösung) gepuffert war. Nach dem Einweichen wurden die pH-Werte der gepufferten Lösung gemessen und die Ionenkonzentration wurde mittels induktiver Plasma-Atomemissionsspektroskopie (ICP-OES, Optima 3000 DV, USA) getestet.

Die Fähigkeit der Beschichtungen, die Ausfällung von Ca- und Phosphor (P) -Verbindungen zu induzieren, wurde durch Eintauchen der Beschichtungen in zellfreies Kulturmedium bewertet. Kurz gesagt, Beschichtungen wurden durch Eintauchen in 70% ige Ethanollösung über Nacht sterilisiert und dann mit phosphatgepufferter Salzlösung (PBS) gewaschen, bevor sie in Kulturmedium eingeweicht wurden. Drei Milliliter Kulturmedium wurden in jede Vertiefung einer Kulturplatte mit 12 Vertiefungen gegeben, die Beschichtungsproben enthielt. Die Beschichtungsproben wurden 5 Stunden bei 37 ° C in einer angefeuchteten 5% CO 2 -Atmosphäre inkubiert und dann mit Reinstwasser gewaschen, getrocknet und zur SEM-Beobachtung mit Kohlenstoff besprüht. Die chemische Zusammensetzung der nach der Mineralisierung auf der Beschichtungsoberfläche gebildeten Ablagerungen wurde unter Verwendung der energiedispersiven Spektroskopie (EDS) analysiert, die an dem SEM-Instrument angebracht war.


2.4. Isolierung und Kultur primärer humaner Osteoblasten

Die Genehmigung zur Verwendung von ausrangiertem menschlichen Gewebe wurde vom Human Ethics Committee der University of Sydney erteilt und die Einverständniserklärung wurde eingeholt. Primäre humane Osteoblasten (HOBs) wurden wie zuvor beschrieben aus normalem humanen trabekulären Knochen isoliert [34]. Kurz gesagt, der Knochen wurde in 1 mm3-Stücke geteilt, mehrmals in PBS gewaschen und mit 0,02% (Gew./Vol.) Trypsin (Sigma-Aldrich, USA) in PBS, pH 7,4, für 90 Minuten bei 37 ° C verdaut. Die Zellen wurden dann in einem vollständigen Medium kultiviert, das a-Minimal Essential Medium (a-MEM, Gibco Laboratories, USA) enthielt, ergänzt mit 10% (v / v) hitzeinaktiviertem fötalem Kälberserum (FCS, Gibco Laboratories), 2 mM L-Glutamin (Gibco Laboratories), 25 mM Hepes-Puffer (Gibco Laboratories), 2 mM Natriumpyruvat, 30 mg ml -1 Penicillin, 100 mg ml -1 Streptomycin (Gibco Laboratories) und 0,1 mM L-Ascorbinsäurephosphatsalz ( Wako Pure Chemicals, Osaka, Japan). Die Zellen wurden bei 37 ° C in einer Atmosphäre von 5% CO 2 kultiviert und die Medien wurden alle drei Tage aufgefrischt. Bei der Konfluenz wurden die Zellen passagiert und die an Passage 3 wurden in den Experimenten verwendet.



2,5. Zellanhaftung und morphologische Beobachtung

Nachdem die Zellen eine Konfluenz von 80–90% erreicht hatten, wurden sie mit TrypLE Express (Invitrogen) trypsinisiert, anschließend zentrifugiert und in vollständigen Medien suspendiert, um eine Zellsuspension mit einer Dichte von 3,4 × 10 4 Zellen pro Milliliter herzustellen. Dann wurde eine 1 ml-Zellsuspension in jede Vertiefung einer Zellkulturplatte mit 24 Vertiefungen gegeben, die Beschichtungsproben enthielt. Nach 2, 5 und 24 Stunden Kultivierung wurden die Zellen in einer 4% igen Paraformaldehydlösung fixiert, mit 1% igem Osmiumtetroxid in PBS für 1 Stunde nachfixiert und anschließend in einer Reihe abgestufter Ethanollösung (30, 50 ° C) entwässert. 70, 90, 95 und 100%) und schließlich 3 min in Hexamethyldisilizan getrocknet. Die getrockneten Beschichtungsproben wurden vor der SEM-Beobachtung mit Gold gesputtert.



2.6. Zellproliferationsassay

Der CellTiter 96-wässrige Test (Promega, USA), ein kolorimetrisches Verfahren, wurde zur Bestimmung der Anzahl lebender Zellen verwendet. Der Assay ist eine kombinierte Lösung von Tetrazoliumverbindung 3- (4,5-Dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl-2H-tetrazolium) (MTS) und einem Elektronenkupplungsreagens (Phenazinmethosulfat) mit einem Volumenverhältnis von 20: 1. Die erstgenannte Verbindung kann durch lebensfähige Zellen in ein Formazan umgewandelt werden, das in Zellkulturmedium löslich ist. Die Extinktion des Formazans bei 490 nm ist also direkt proportional zur Anzahl der lebensfähigen Zellen. Für jeden Zeitpunkt wurden vier Proben jedes Typs von Beschichtungen getestet, und die unbeschichteten Ti-6Al-4V- Scheiben wurden als Kontrolle verwendet. Kurz gesagt wurde 1 ml Zellsuspension mit einer Zelldichte von 8,5 × 10 4 ml / ml in jede Vertiefung einer Kulturplatte mit 24 Vertiefungen gegeben, die die Beschichtungsproben enthielt. Nach 3 und 7 Tagen wurde das Kulturmedium durch 700 μl der MTS-Arbeitslösung ersetzt, bei der es sich um eine fünffach verdünnte Lösung des CellTiter 96-wässrigen Assays in PBS handelte. Nach 4 h weiterer Inkubation wurden 100 ml der Arbeitslösung in eine Zellkulturplatte mit 96 Vertiefungen übertragen, um die Extinktion unter Verwendung eines Mikroplattenlesegeräts (PathTech) bei 490 nm zu messen.


2,7. Quantitative Echtzeit-Polymerase- Kettenreaktion

HOBs wurden bei einer Zelldichte von 2 × 10 4 Zellen cm –2 auf die Beschichtungsproben ausgesät und 1 Tag und 7 Tage kultiviert . Nach jedem Zeitpunkt wurde die Gesamt-RNA aus HOBs isoliert, die auf Beschichtungsproben und den Kontrollproben von unbeschichteten Ti-6Al-4V- Scheiben kultiviert wurden, indem Trizol (Sigma) gemäß den Anweisungen des Herstellers verwendet wurde. Erststrang-cDNA wurde aus 0,7 ug Gesamt-RNA unter Verwendung des Omniscript RT Kit (Qiagen, USA) gemäß den Anweisungen des Herstellers synthetisiert. Die cDNA wurde dann durch Echtzeit-PCR (Rotor-Gene 6000, Corbett Life Science) auf die mit Osteoblasten verwandten Gene analysiert: Runx-2, Kollagen Typ I, Osteopontin (OPN) und Knochensialoprotein (BSP) und ihre relative Genexpression Niveaus wurden durch Normalisieren auf Glyceraldehyd-3-phosphatdehydrogenase (GAPDH) erhalten.

Die für die ausgewählten Gene verwendeten Primer sind in Tabelle 1 aufgeführt.


2.8. statistische Analyse

Die Daten wurden aus vier unabhängigen Experimenten erhalten und als Mittelwert ± sd ausgedrückt. Für die statistische Analyse wurde das Programm SPSS 17.0 verwendet. Der Levene-Test wurde durchgeführt, um die Homogenität der Varianz für alle Daten zu bestimmen , und dann wurden Tukey-HSD-Post-hoc-Tests für die Daten mit homogener Varianz verwendet, ansonsten wurde Tamhanes T2-Post-hoc eingesetzt.

Ein p-Wert von weniger als 0,05 wurde als signifikant angesehen.



******Fortsetzung folgt******